IDENTIFICATION AND DIFFERENTIATION OF THE ENTOMOPATHOGENIC FUNGUS BEAUVERIA-BASSIANA USING POLYMERASE CHAIN-REACTION AND SINGLE-STRAND CONFORMATION POLYMORPHISM ANALYSIS

A series of genomic DNA probes which exhibit specificity for Beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal DNA (Hegedus and Khachatourians, 1993a). To improve the sens itivity of a DNA-based monitoring system for detection of this entomop athogenic fungus we have developed a PCR-based method. Using sequence information from a region of the B. bassiana-specific probe pBb22, pri mers P1 (5'AAGCTTCGACATGGTCTG) and P3 (5'GGAGGTGGTGAGGTTCTGTT) were ge nerated. This primer set amplified similar-sized products from several B. bassiana isolates, Beauveria brongniartii, Beauveria caledonica, a nd B. densa, but not Tolypocladium nivea, Tolypocladium cylindrospora, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farino sus or migratory grasshoppers and locusts. Hybridization with the prob e indicated the presence of DNA homology between the products. Restric tion enzyme analysis of the PCR products, however, showed that sequenc e heterogeneity existed which was confirmed by partial sequencing of t he products. Another primer, P5 (5'AGGAGAGAGCTCGACGGTCA), was develope d to exploit the sequence variations. When the P1-P5 primer set was us ed, a product was amplified from most B. bassiana isolates, including two which failed to amplify with the P1-P3 set. This amplification was not observed with the other Beauveria species tested. The nature of t he sequence variations within the P1-P3 PCR-amplified region suggests the placement of B. densa and B. caledonica outside the species B. bas siana, confirming previous evidence with mitochondrial DNA and DNA pro bes. PCR with the P1-P3 and P1-P5 primer sets was used to discriminate isolates of B. bassiana found to be infecting a population of the mig ratory grasshopper, Melanoplus sanguinipes, collected in Saskatchewan. The PCR products derived from the P1-P3 primer set with the various B eauveria spp. could be differentiated by single-strand conformation po lymorphisms (SSCP). Thus, analysis of PCR products using restriction e nzymes, sequencing, or SSCPs allows positive differentiation of a part icular B. bassiana isolate from others. The great sensitivity of these techniques should help the release and monitoring of entomopathogenic fungi in the environment. (C) 1996 Academic Press, Inc.