Fragile sites are nonstaining gaps in chromosomes induced by specific
tissue culture conditions. They vary both in population frequency and
in the culture conditions required for induction. Folate-sensitive fra
gile sites are due to expansion of p(CCG)(n) trinucleotide repeats; ho
wever, the relationship between sequence composition and the chemistry
of induction of fragile sites is unclear. To clarify this relationshi
p, the distamycin A-sensitive fragile site FRA16B was isolated by posi
tional cloning and found to be an expanded 33 bp AT-rich minisatellite
repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent wit
h DNA sequence binding preferences of chemicals that induce its cytoge
netic expression). Therefore the mutation mechanism associated with tr
inucleotide repeats is also a property of minisatellite repeats (varia
ble number tandem repeats).