Csb. Martins et al., FREQUENCY OF THE CYSTIC-FIBROSIS DELTA-F-508 MUTATION IN A POPULATIONFROM SAO-PAULO STATE, BRAZIL, Brazilian journal of medical and biological research, 26(10), 1993, pp. 1037-1040
Cystic fibrosis (CF) nonrelated patients (N = 24) from Sao Paulo State
, Brazil, were screened for the presence of the DELTAF 508 mutation by
PCR amplification of the deletion region with the primers C16B(5'GTTT
TCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGAT-GACGCTTC3') and
by acrylamide gel electrophoresis.The allelic frequency of the DELTAF
508 mutation was 33 % (15/48 chromosomes). The genotype distribution a
mong the patients showed 12.5 % (N = 3) of DELTAF 508 homozygotes, 37.
5 % (N = 9) of DELTAF heterozygotes and 50 % (N = 12) of non-carriers
of the mutation. The frequency observed in this study is lower than th
at estimated for the North American and North European population (75
% to 80 %) and is similar to that described in Southern Europe (25 % t
o 50 %) which is consistent with the origins of this population.