DIAGNOSTIC EVALUATION OF POLYMERASE CHAIN-REACTION DISCRIMINATIVE FORBORDETELLA-PERTUSSIS, B-PARAPERTUSSIS AND B-BRONCHISEPTICA

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronehiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with s uspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using p rimers BOUNI 1: 5'GCACCATCCCGCATACGTGTTG3', and BOUNI 2: 5'GTGCAACGCAT CCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzy me cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals similar to 30 bacteria). No false positives were found in clinical samples or among 18 other species. Tr eatment of 66 aspirates with a weak cation exchange resin increased th e diagnostic sensitivity of pen. Two culture-positive aspirates were n egative by PCR, but grew with a single colony among contaminating flor a and could be identified only after PCR analysis of the colony materi al. The amount of positive cases was increased from 13 by culture to 1 9 by the addition of pen. Six samples positive by PCR were culture neg ative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCA i ncreased the sensitivity of pertussis case finding with retained speci ficity and can be used for laboratory diagnosis of whooping cough.