ACTIVATION OF MYOD GENE-TRANSCRIPTION BY 3,5,3'-TRIIODO-L-THYRONINE -A DIRECT ROLE FOR THE THYROID-HORMONE AND RETINOID-X RECEPTORS

Thyroid hormones are major determinants of skeletal muscle differentia tion in vivo. Triiodo-L-thyronine treatment promotes terminal muscle d ifferentiation and results in increased MyoD gene transcription in myo genic cell lines; furthermore myoD and fast myosin heavy chain gene ex pression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). W e have identified a Tg response element (TRE) in the mouse MyoD promot er between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGG AGGAGTAGA 3'). This sequence conferred an appropriate T3 response to a n enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric comp lex, with either the retinoid X receptor alpha or gamma 1 isoforms (RX R alpha, RXR gamma), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Ana lyses of this heterodimer with a battery of steroid hormone response e lements indicated that the complex was efficiently competed by a direc t repeat of the AGGTCA motif separated by 4 nucleotides as predicted b y the 3-4-5 rule. EMSA experiments demonstrated that the nuclear facto r(s) present in muscle cells that bound to the myoD TRE were constitut ively expressed during myogenesis; this complex was competed by the my osin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively exp ressed during C2C12 differentiation. Mutagenesis of the myoD TRE indic ated that the sequence of the direct repeats (AGGTCA) and the 4 nucleo tide gap were necessary for efficient binding to the TR alpha/RXR alph a heterodimeric complex. In conclusion our data suggest that the TRE i n the helix loop helix gene, myoD, is a target for the direct heterodi meric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on i n vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.