M. Delepierre et al., CONFORMATIONAL STUDIES BY H-1-NMR OF THE HIV ENHANCER - THE TRANSCRIPTION FACTORS NF-KAPPA-B AND SP1 BINDING DOMAINS, Magnetic resonance in chemistry, 34, 1996, pp. 67-80
The solution structures of two DNA non-palindromic duplexes of 24 base
pairs and corresponding to the 3' NF-KB-binding site and the adjacent
5' Sp1-binding site of the HIV-1 long terminal repeat (5'LTR) were an
alyzed by proton two-dimensional nuclear magnetic resonance spectrosco
py. The first sequence GACTTTCCAGGGAGGCGTGGC):d(GCCACGCCTCCCTGGAAAGTCC
CC) corresponds to the wild-type LTR duplex (24mer-N), and the second
sequence CACTTTCCAGGGAGGCGTGGC):d(GCCACGCCTCCCTGGAAAGTGAGC) (24mer-M)
contains a specific mutation (lightface letters) abolishing NF-KB bind
ing, Assignment of protons essential for structure determination were
obtained and structural features of both duplexes were analyzed. The o
verall structure of the duplex is of the B form but several significan
t local structural deviations were found. First, from analysis of NOE
cross-peak intensities between adenine H2 base protons and sugar H1' p
rotons, it was found that the CTC mutation results in widening of the
minor groove with presumably narrowing of the major groove, thus impai
ring the binding of NF-KB to its responsive element in the HIV LTR. Se
cond from chemical shift analysis of H1' sugar protons, some unusual s
tructural features were found at the junction between the homopurine:h
omopyrimidine stretches, that is, at the junction of the NF-KB and Sp1
sites, consistent with the known synergism between NF-KB and Sp1 func
tions in the HIV LTR. The scopes and limitations of DNA fragment studi
es of such a size are discussed.