HAIRPIN FORMATION WITHIN THE HUMAN ENKEPHALIN ENHANCER REGION .2. STRUCTURAL STUDIES

Receptor-mediated induction of the human proenkephalin gene has been m apped to an imperfect palindrome located between -104 and -86, upstrea m of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reve rsible conformational change from duplex to a hairpin state of the enh ancer [McMurray, C. T., Wilson, W. D., & Douglass, J. O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]; To determine the structure that woul d form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGC AGGCCCTACGCCAGC), whose sequences are identical to the top and the bot tom strands of the native enhancer. We have found that each oligonucle otide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0 -45 degrees C). The assignment of each imino proton was carried out us ing 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hair pin structure for each oligonucleotide contains a 3-member loop, a 10- bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate eleme nt binding protein (CREB), a transcription factor that binds to and re gulates the human proenkephalin gene. Circular dichroism and P-31 NMR indicate that, despite the presence of mismatched pairs, each oligonuc leotide hairpin adopts a B-form conformation with no unusual bending o r kinking. The structure of the hairpin may explain the effect on expr ession of point mutations within the enhancer.