The protein product of the normal p53 gene binds to the DNA p53CON ele
ment (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating tra
nscription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 2
81 (Asp-->Gly), failed to bind p53CON and to activate transcription. H
owever, in contrast to previous reports that all p53 mutants fail to b
ind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala
) and 273 (Arg-->His), retained both p53CON binding and transcriptiona
l activation functions. A third mutant 175 (Arg-->His) bound to the p5
3CON but did not activate transcription. These data suggest that the D
NA binding and transcriptional activation functions of p53 mutants in
tumor cells are dependent on the specific missense mutations acquired
in the p53 gene and the target sequences of p53 in the genome.