IN-VITRO AMPLIFICATION OF GENOME FRAGMENT OF BOVINE VIRAL DIARTHOEA-MUCOSAL DISEASE (BVD-MD) BY PCR METHOD

DNA in-vitro amplification when a PCR (polymerase chain reaction) meth od is used (S a i k i et al., 1985) provides for a simple technique of marked amplification of a selected DNA fragment. The length of a DNA amplified fragment is determined by two synthetic primers which sponta neously (at an appropriate temperature) hybridize with the opposite en ds of antiparallelly oriented strains of denatured DNA. The enzyme Taq polymerase completes the synthetisation of new DNA strains from the p rimers. Repetition of these cycles (denaturing, primer bonds, DNA synt hesis) enhances the DNA amplification of a defined strain length to su ch an extent that is possible to prove this process by e.g. electropho retic analysis. For the purposes of a proof of BVD-MD genome in cattle the fragment 315 bp was chosen from the virus-coding gene gp 80. The primers P1 - 5 - GTAGGTAGAGTGAAACCCGG - 3' and P2 - 5' - CGGGACCTGGACT TCATAGC - 3'(Hertig et al., 1991) determined the length of the amplifi ed fragment. Virus RNA was isolated from the infectious BVD-MD-contain ing medium (Ph strain) using a phenol-chloroform (1:1) mixture, and be fore amplification it was transcribed to cDNA in the P2 presence by th e effect of AMV reverse transcriptase. cDNA without isolation from the transcription reaction mixture was directly used for PCR. DNA was den atured at 94-degrees-C for 10 minutes before the outset of amplificati on. These reaction conditions are suitable for the PCR method: P1 and P2 primer concentrations per 100 mul reaction solution - 1 muM, dNTP - 100 muM 2 - 4 U Taq polymerase, 25 - 35 amplification cycles with the temperature regime: 94-degrees-C/I min, 56-degrees-C/1 min, 73-degree s-C/l min, and prolonged incubation 73-degrees-C/7 min in the last cyc le. Proof of the amplified product 315 bp DNA - electrophoretic analys is of 1.5 to 2% agarose gel in TAE buffer and ethidium bromide stainin g of gel are suitable. The introduced PCR method gives opportunities f or innovations of BVD-MD diagnosis in cattle on the basis of virus gen ome proof without any cell cultivation need.