Identification of a transcription factor that binds to the promoter regionof the human parathyroid hormone gene

A putative transcription factor binds a site adjacent to the negative vitam in D responsive element (VDRE) in the promoter region of the human parathyr oid hormone gene. Deletion and mutation analysis reveal the binding site fo r this factor overlaps with the proximal repeat element of the VDRE. It inc ludes additional nucleotides at the 3' end of the VDRE, This site has the s equence TTTGAAACCTATAGTTGAGAT and a core sequence TGAACCTAT needed for bind ing of the factor. Experiments with specific anti-vitamin D receptor (VDR) antibodies demonstrate that VDR is not found in the factor/DNA complex. How ever, removing the VDR from the nuclear extract by immunoprecipitation elim inated the binding complex, and the addition of recombinant VDR to the depl eted extract did not restore the factor's ability to bind to the DNA, sugge sting that the factor and VDR are closely associated. Transfection experime nts with various reporter constructs indicate that the factor is required f or the high transcriptional activity of the human PTH gene. This high activ ity is significantly suppressed by 1,25-dihydroxyvitamin D-3. This factor s eems to be expressed in several cell types including rat osteoblasts and pi tuitary, Additionally, some human cancer cell lines express a high level of this factor. (C) 1999 Academic Press.