Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nucl ear proteins from human myometrium at parturition, To elucidate the molecul ar mechanisms involved in OTR gene upregulation at term, the US-2 element w as used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophor etic mobility shift assay for their ability to bind the human OTR gene prom oter, containing the US-2 motif, A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a tra nsactivation domain. Furthermore, Northern hybridization showed strong hMaf F mRNA expression in the kidney and in term myometrium only, but not in non pregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The high ly specific binding of hMafF to the US-2 motif in the human OTR gene, toget her with its pattern of expression, supports a role for hMafF in OTR gene u pregulation at term. (C) 1999 Academic Press.