CB1 receptor density and CB1 receptor-mediated functional effects in rat hippocampus are decreased by an intracerebroventricularly administered antisense oligodeoxynucleotide

We have studied (i) the effect of antisense oligodeoxynucleotides complemen tary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and c erebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (A S1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mism atch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACT ATGGACTG) were used. The dissociation constant (K-D) of rat CB, cannabinoid receptors, la belied by the radioligand [H-3]-SR141716, did not differ in membranes from rats treated with saline, AS1, AS2 or MM. The density of rec eptor binding (B-max) was reduced by the antisense oligodeoxynucleotides, 1 0 nmol, in the hippocampus (AS1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised t o 30 nmol, the reduction of B-max in the hippocampus and striatum was only marginally increased; a dose of 3 nmol of AS1 reduced B-max in both brain r egions by somewhat more than the half-maximum effect. The mismatch oligodeo xynucleotide MM (3-30 nmol) did not affect B-max. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with A S1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-p olymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following trea tment with saline or MM in the hippocampus, striatum and cerebral cortex. F inally, pretreatment with antisense oligodeoxynucleotide AS1 30 nmol attenu ated two functional effects via CB1 receptors, i.e., the facilitatory effec t of WIN 55,212-2 on [S-35]-GTP gamma S binding in rat hippocampus membrane s and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density o f CB1 receptors in the rat hippocampus and striatum after i.c.v. administra tion. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not ap pear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment wi th AS1 attenuated the CB1 receptor-mediated effect in two functional models .