Homologous human and murine antisense oligonucleotides targeting Stat6 - Functional effects on germline C epsilon transcript

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via ac tivation of the transcription factor signal transducer and activator of tra nscription (Stat)6. The present study describes the identification and char acterization of antisense oligonucleotides to Stat6 as an approach to inter rupt IL-4 and IL-13 signaling and thereby to attenuate germline C epsilon t ranscription, a prerequisite to IgE synthesis. A limited gene-walk was perf ormed with chemically modified oligonucleotides to identify sequences capab le of downregulating both human and murine StatG. A chimeric oligonucleotid e (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of anti sense activity in both species. Further characterization of 9b showed a dos e-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentr ation that produces 50% inhibition of effect = 168 and 215 nM, respectively ) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b, before 11 ,-4 stimulation successfully downregulated germline CE transcription. Becau se Stat6 represents an attractive but technically challenging drug discover y target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling. Hi ll, S., E. Herlaar, A. Le Cardinal, G. van Heeke, and P. Nicklin. 1999. Hom ologous human and murine antisense sligonucleotides targeting Stat6: functi onal effects on germline C epsilon transcript.