A study of 45,X/46,XX mosaicism in Turner syndrome females: A novel primerpair for the (CAG)(n) repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of dipare ntal/uniparental origin of X chromosomes in mosaic Turner females (karyotyp e 45,X/46,XX), and accounts for results of the analysis of chromosomal mate rial from 20 girls with Turner syndrome. An (CAG)(n) repeat within the andr ogen receptor (AR) gene was selected as a genetic marker. A novel primer pa ir for amplification of the (CAG)(12-30) repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5' - -> 3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subje cts were heterozygous for the selected marker. In 4 cases there were distin ct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic t echniques, proved to be a cryptic mosaic, displaying two alleles of the gen etic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner fem ales arises through loss of one of the X chromosomes in some cell lints in originally 46,XX conceptuses, rather than through mitotic non-disjunction d uring early embryogenesis in originally 45,X conceptuses. A high sensitivit y of the modified assay based on PCR-amplification of the (CAG)(n) repeat w ithin AR gene proves its usefulness as a tool for studying mosaicism in Tur ner syndrome.