Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile

Sequence analysis was carried out of a human clone pBA0.6 generated after e xonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was CC-rich and minisatellitic in nature. Genomic blots of Hae III-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb, Hybridization analyses of 88 unrelated in dividuals belonging to four regions of India using this probe revealed poly morphic bands which were individual specific. The probability of identity r anged from 5.07 x 10(-14) in Punjabis to 2.64 x 10(-16) in Bengalis and was found to be 3.06 x 10(-16) in UPites, whereas in the case of South Indians , it was 3.9 x 10(-15) Three sets of isomorphic bands at 29.0 kb, 2.4 kb, a nd 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens spec ific. Construction of dendrograms based on the UPGMA method with Jaccard's coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were rando m. Maximum likelihood estimates through the bootstrap sampling method showe d that Punjabis, Bengalis, and UPites formed one cluster, whereas South Ind ians formed a separate cluster, altogether thus showing the proximity of th ese three population groups compared with that from South India. A prelimin ary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb, This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames wi thin the minisatellite sequence, were obtained. The role of the two transcr ipts from the minisatellite sequence is not clear as yet, and it is probabl e that these messages may not get translated because of the absence of a eu karyotic Kozak sequence around the initiator methionine in the pBA0.6 seque nce.