A novel glucocorticoid receptor binding element within the murine c-myc promoter

In the course of analyzing the murine c-myc promoter response to glucocorti coid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocortico ids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element int o SV40/reporters inhibits basal reporter gene activity in the absence of gl ucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude th at the glucocorticoid receptor binds to the c-myc promoter in competition w ith this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been repor ted.