Identification and characterization of two androgen response regions in the human neutral endopeptidase gene

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androg en regulated in prostate cancer cells. Homology search identified a sequenc e GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT wit hin the 3'-untranslated region of the NEP mRNA. a double-stranded radiolabe lled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfecte d with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Stero id-dependent enhancement of transcription was assayed by transfecting ptkCA T reporter constructs containing the NEP-ARE into CV-1/AR cells and prostat e cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexametha sone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We n ext performed DNase-I footprinting analysis of the NEP promoter and identif ied a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. T his sequence was 62.5% homologous to an androgen responsive region (PSA-ARR ) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequ ence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP- ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enha ncement of CAT activity was increased 2.3-fold by androgen, but not by gluc ocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in P C cells. These data suggest that steroid regulation of the NEP gene involve s at least two elements including a typical ARE which binds androgen, proge sterone and glucocorticoid receptors, and a unique ARR which only binds and rogen receptor. (C) 2000 Elsevier Science Ireland Ltd. All rights reserved.