Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells

Context.-Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and dis rupts TATA box-binding protein/ TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these act ions. Objective.-To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H -1 myocytes or HL-60 cells is associated with the intracellular accumulatio n of the nuclear transcription factor E2F-1, known to induce apoptosis. Methods.-The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that containe d an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction. Results.-Nuclear extracts from each cell line treated with 26.7 mu mol/L Ho echst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [P-32]-l abeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATT TGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoech st 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly in creased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. H oechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines. Conclusion.-Hoechst 33342-induced apoptosis is associated with intracellula r accumulation of E2F-1 protein, another step in this specific apoptotic pa thway.