Reusable solid-phase supports for oligonucleotides and antisense therapeutics

A general method for oligonucleotide synthesis on reusable solid-phase supp orts has been developed which will significantly lower the cost of large-sc ale synthesis. It consists of five steps: 1, nucleoside attachment to an hy droxy derivatized support through a Q-linker (hydroquinone-O, O'-diacetic a cid) linker arm; 2, chloro-acetylation of unreacted surface groups; 3, conv entional phosphodiester or phosphorothioate oligonucleotide synthesis; 4, c leavage from the support with aqueous or anhydrous ammonia; and 5; support regeneration with methanolic potassium carbonate. The recycling process is fast, fully automatable, and does not require removal of the support from t he synthesis column. Fifteen solid-phase supports were evaluated with glyce rol-CPG providing the best results. Consecutive syntheses of ISIS 2302, a d GCCCAAGCTGGCATCCGTCA phosphorothioate sequence, on the same synthesis colum n were performed. A glycerol-CPG synthesis column was satisfactorily used s ix consecutive times when NH4OH was the cleavage reagent. However, anhydrou s NH3 allowed twelve consecutive syntheses without any deterioration in sup port loading, product quality, or amount of product produced. An improved m ethod for preparing the essential nucleoside-3'-hemiesters of the Q-Linker and an unexpectedly slower rate of cleavage for phosphorothioate DNA vs. ph osphodiester DNA are also described.